EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr14:104321228-104322087]
Chromosome characteristics of ZNF143[chr14:104321228-104322087]
Back to top
Enhancers possibly regulated by ZNF143[chr14:104321228-104322087]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 104318405 104331075 enh15981
Prostate (PC-3) Epithelial (MCF-7) Prostate (RWPE1) Esophagus Lung Stomach Muscle (A673) Placenta Thyroid Lung (PC-9) Pancreas Uterus Heart
SNP sites on ZNF143[chr14:104321228-104322087]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 104321261 rs7140323 C T 3817185
chr14 104321303 rs11625216 G A 3817186
chr14 104321376 rs184027820 G T 3817187
chr14 104321377 rs186796171 T C 3817188
chr14 104321517 rs191258519 C G 3817189
chr14 104321528 rs566130272 C T 3817190
chr14 104321712 rs538172046 C T 3817191
chr14 104321723 rs56918740 C G 3817192
chr14 104321791 rs552554395 C T 3817193
chr14 104321853 rs113956414 G A 3817194
chr14 104321930 rs149834061 CAGGCCGACTCCCACCCCACCCT C 3817195
chr14 104321936 rs184224593 G A 3817196
chr14 104321960 rs111962153 G A 3817197
chr14 104322026 rs3861678 A G 3817198
chr14 104322042 rs566072736 G A,C 3817199
chr14 104322061 rs3890362 A T 3817200
chr14 104322082 rs151005065 G A,C 3817201
Genes possibly regulated by ZNF143[chr14:104321228-104322087]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr14:104321228-104322087]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results