Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 104342958 104366807 enh15983

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 104342050 rs554728322 G A 3817509
chr14 104342117 rs548856692 GAGCCGAGATCATGCCACTGCACTCT G 3817510
chr14 104342165 rs189937583 G A 3817511
chr14 104342234 rs141748055 G A 3817512
chr14 104342665 rs147069977 T G 3817513
chr14 104342754 rs147689524 T C 3817514

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results