EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr14:104748956-104750561]
Chromosome characteristics of ZNF274[chr14:104748956-104750561]
Back to top
Enhancers possibly regulated by ZNF274[chr14:104748956-104750561]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 104739745 104749258 enh109663
Cervix (HeLa-S3) Brain (SK-N-SH) Stomach
chr14 104749554 104768875 enh68851
Cervix (HeLa-S3) Brain (SK-N-SH) Muscle (A673) Pancreas Neural Stem Cells (H9)
SNP sites on ZNF274[chr14:104748956-104750561]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 104748978 rs553281635 GAGGC G 3820776
chr14 104749004 rs147590734 G C 3820777
chr14 104749048 rs7153223 T C 3820778
chr14 104749120 rs142015930 G C 3820779
chr14 104749147 rs373162908 CCCTT C 3820780
chr14 104749147 rs573034435 CCCTT C 3820781
chr14 104749187 rs553184302 C A 3820782
chr14 104749212 rs561222206 A G 3820783
chr14 104749233 rs11850450 C T 3820784
chr14 104749234 rs11850420 A G 3820785
chr14 104749269 rs540710610 C G 3820786
chr14 104749318 rs11850496 C T 3820787
chr14 104749383 rs59771397 G A 3820788
chr14 104749399 rs11160798 T C 3820789
chr14 104749474 rs567094341 G T 3820790
chr14 104749593 rs114775459 C G 3820791
chr14 104749653 rs545653618 A G,T 3820792
chr14 104749671 rs10136831 T C 3820793
chr14 104749735 rs561391969 G C 3820794
chr14 104749761 rs115993688 C T 3820795
chr14 104749830 rs532762030 G A 3820796
chr14 104749877 rs375305266 AGCAG A 3820797
chr14 104749971 rs561876543 ACTGTGCCTTCTGGGAAGGCTG A 3820798
chr14 104749992 rs568474298 G A 3820799
chr14 104750009 rs549974839 G A 3820800
chr14 104750030 rs188008619 G A 3820801
chr14 104750032 rs79417034 G T 3820802
chr14 104750081 rs145215125 T TG 3820803
chr14 104750085 rs28411179 G T 3820804
chr14 104750087 rs11626849 T C,G 3820805
chr14 104750123 rs11622102 A G 3820806
chr14 104750189 rs564222087 C T 3820807
chr14 104750228 rs75375763 C G 3820808
chr14 104750243 rs150278498 C T 3820809
chr14 104750257 rs139014709 G A 3820810
chr14 104750266 rs531900576 C G,T 3820811
chr14 104750388 rs7147827 A G 3820812
Genes possibly regulated by ZNF274[chr14:104748956-104750561]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr14:104748956-104750561]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results