EnhancerDB
  1. Home
  2. TFBS
  3. ZZZ3[chr14:105434285-105434655]
Chromosome characteristics of ZZZ3[chr14:105434285-105434655]
Back to top
Enhancers possibly regulated by ZZZ3[chr14:105434285-105434655]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 105430265 105443481 enh15985
Prostate (PC-3) Cervix (HeLa-S3) Epithelial (MCF-7) Brain (SK-N-SH) Large Intestine Ovary Esophagus Astrocyte Bone (Osteoblast) Stomach Muscle (A673) Placenta Thyroid Pancreas Pancreas (Panc1) Muscle (Myotube) Uterus Heart
chr14 105434041 105434308 vista19258
VISTA
SNP sites on ZZZ3[chr14:105434285-105434655]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 105434292 rs74809562 G C 3826916
chr14 105434356 rs116381596 T A 3826917
chr14 105434357 rs74090142 T C 3826918
chr14 105434615 rs112312376 G A 3826919
chr14 105434646 rs139284487 TGCCTCCCCGAGAACTGGACTATCCTG T 3826920
chr14 105434646 rs376491872 TGCCTCCCCGAGAACTGGACTATCCTG T 3826921
Genes possibly regulated by ZZZ3[chr14:105434285-105434655]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZZZ3[chr14:105434285-105434655]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results