EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr14:105559261-105559848]
Chromosome characteristics of ZNF143[chr14:105559261-105559848]
Back to top
Enhancers possibly regulated by ZNF143[chr14:105559261-105559848]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 105549318 105571095 enh15987
Brain (SK-N-MC) Astrocyte Colon (HCT116) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Brain (SK-N-SH) Bone (Osteoblast) Pancreas (Panc1) Thymus Prostate (PC-3) Cervix (HeLa-S3) Esophagus Placenta Lung (PC-9) Muscle (Myotube) Prostate (RWPE1) Muscle (A673) Heart
SNP sites on ZNF143[chr14:105559261-105559848]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 105559298 rs144085357 TG T 3828126
chr14 105559300 rs202128835 G A,C,T 3828127
chr14 105559441 rs587679144 AGGGGGCCCGGAAGCTCCCTG A 3828128
chr14 105559489 rs55849896 G C 3828129
chr14 105559520 rs142113864 G A,C 3828130
chr14 105559530 rs183123425 G A,T 3828131
chr14 105559571 rs114528103 A T 3828132
chr14 105559583 rs587731085 GC G 3828133
chr14 105559610 rs34364862 C T 3828134
chr14 105559681 rs587728063 G A,C 3828135
chr14 105559745 rs587659698 C T 3828136
Genes possibly regulated by ZNF143[chr14:105559261-105559848]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr14:105559261-105559848]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results