Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 105559441 rs587679144 AGGGGGCCCGGAAGCTCCCTG A 3828128
chr14 105559489 rs55849896 G C 3828129
chr14 105559520 rs142113864 G A,C 3828130
chr14 105559530 rs183123425 G A,T 3828131
chr14 105559571 rs114528103 A T 3828132
chr14 105559583 rs587731085 GC G 3828133
chr14 105559610 rs34364862 C T 3828134
chr14 105559681 rs587728063 G A,C 3828135

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results