EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr14:105562500-105564661]
Chromosome characteristics of ZNF143[chr14:105562500-105564661]
Back to top
Enhancers possibly regulated by ZNF143[chr14:105562500-105564661]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 105549318 105571095 enh15987
Brain (SK-N-MC) Astrocyte Colon (HCT116) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Brain (SK-N-SH) Bone (Osteoblast) Pancreas (Panc1) Thymus Prostate (PC-3) Cervix (HeLa-S3) Esophagus Placenta Lung (PC-9) Muscle (Myotube) Prostate (RWPE1) Muscle (A673) Heart
SNP sites on ZNF143[chr14:105562500-105564661]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 105562576 rs182032803 G A 3828173
chr14 105562601 rs56855842 G A 3828174
chr14 105562634 rs201615039 TA T 3828175
chr14 105562639 rs78403573 G A 3828176
chr14 105562683 rs187428145 C T 3828177
chr14 105562697 rs12885315 C G 3828178
chr14 105562732 rs12885313 A G 3828179
chr14 105562735 rs12886669 T C 3828180
chr14 105562746 rs12886677 T C 3828181
chr14 105562765 rs12885324 A G 3828182
chr14 105562919 rs79319348 C T 3828183
chr14 105562989 rs180985618 C A,G 3828184
chr14 105562994 rs142056666 C T 3828185
chr14 105563054 rs185858069 G A,T 3828186
chr14 105563055 rs112083414 C T 3828187
chr14 105563060 rs56256371 C A 3828188
chr14 105563089 rs73367185 G C 3828189
chr14 105563105 rs587620245 G C 3828190
chr14 105563119 rs115628253 A C 3828191
chr14 105563120 rs116356600 G A 3828192
chr14 105563140 rs190658537 G A 3828193
chr14 105563144 rs587685188 C G 3828194
chr14 105563167 rs73367186 G A 3828195
chr14 105563171 rs189129989 A G 3828196
chr14 105563183 rs138718314 C CCCTACCGGCCCCTACTCCAGTGCTGACTCCTCCTCA,CCCTACCGGCCCCTACTCCAGTGCTGACTCTTCCTCA 3828197
chr14 105563215 rs72705770 T C 3828198
chr14 105563220 rs77163506 C T 3828199
chr14 105563262 rs11160834 T A 3828200
chr14 105563311 rs36171475 T C 3828201
chr14 105563315 rs587708053 A T 3828202
chr14 105563367 rs115662163 C T 3828203
chr14 105563369 rs35133619 T C 3828204
chr14 105563398 rs587674366 G A 3828205
chr14 105563406 rs587735386 G A 3828206
chr14 105563460 rs148814357 C T 3828207
chr14 105563468 rs149944579 G GC,GCCCCC,GCCCCG 3828208
chr14 105563495 rs200222284 AC A 3828209
chr14 105563514 rs143403956 C T 3828210
chr14 105563519 rs7155121 T C 3828211
chr14 105563568 rs587764513 C T 3828212
chr14 105563660 rs11850872 G C 3828213
chr14 105563666 rs77549877 A G 3828214
chr14 105563812 rs75589252 C G 3828215
chr14 105563866 rs111902669 C CCT 3828216
chr14 105563866 rs587656570 C G 3828217
chr14 105563867 rs182964005 G A 3828218
chr14 105563903 rs111962115 G A 3828219
chr14 105563904 rs587744918 TACAC T 3828220
chr14 105563963 rs183981539 G A 3828221
chr14 105564051 rs76473343 C T 3828222
chr14 105564052 rs116600693 G A 3828223
chr14 105564147 rs9743945 G A 3828224
chr14 105564158 rs60849362 G C 3828225
chr14 105564310 rs587716751 G A 3828226
chr14 105564333 rs7159744 C T 3828227
chr14 105564336 rs145786670 A G 3828228
chr14 105564496 rs57635291 CT C 3828229
chr14 105564496 rs66465636 CT C 3828230
chr14 105564516 rs76406813 G A 3828231
chr14 105564565 rs185059251 T C,G 3828232
chr14 105564592 rs587670000 T C 3828233
chr14 105564595 rs7161438 T A 3828234
Genes possibly regulated by ZNF143[chr14:105562500-105564661]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr14:105562500-105564661]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results