EnhancerDB
  1. Home
  2. TFBS
  3. TCF7L2[chr14:105562882-105563237]
Chromosome characteristics of TCF7L2[chr14:105562882-105563237]
Back to top
Enhancers possibly regulated by TCF7L2[chr14:105562882-105563237]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 105549318 105571095 enh15987
Brain (SK-N-MC) Astrocyte Colon (HCT116) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Brain (SK-N-SH) Bone (Osteoblast) Pancreas (Panc1) Thymus Prostate (PC-3) Cervix (HeLa-S3) Esophagus Placenta Lung (PC-9) Muscle (Myotube) Prostate (RWPE1) Muscle (A673) Heart
SNP sites on TCF7L2[chr14:105562882-105563237]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 105562919 rs79319348 C T 3828183
chr14 105562989 rs180985618 C A,G 3828184
chr14 105562994 rs142056666 C T 3828185
chr14 105563054 rs185858069 G A,T 3828186
chr14 105563055 rs112083414 C T 3828187
chr14 105563060 rs56256371 C A 3828188
chr14 105563089 rs73367185 G C 3828189
chr14 105563105 rs587620245 G C 3828190
chr14 105563119 rs115628253 A C 3828191
chr14 105563120 rs116356600 G A 3828192
chr14 105563140 rs190658537 G A 3828193
chr14 105563144 rs587685188 C G 3828194
chr14 105563167 rs73367186 G A 3828195
chr14 105563171 rs189129989 A G 3828196
chr14 105563183 rs138718314 C CCCTACCGGCCCCTACTCCAGTGCTGACTCCTCCTCA,CCCTACCGGCCCCTACTCCAGTGCTGACTCTTCCTCA 3828197
chr14 105563215 rs72705770 T C 3828198
chr14 105563220 rs77163506 C T 3828199
Genes possibly regulated by TCF7L2[chr14:105562882-105563237]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TCF7L2[chr14:105562882-105563237]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results