EnhancerDB
  1. Home
  2. TFBS
  3. MYOD[chr15:39787334-39787980]
Chromosome characteristics of MYOD[chr15:39787334-39787980]
Back to top
Enhancers possibly regulated by MYOD[chr15:39787334-39787980]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 39776905 39811915 enh31311
Bone Marrow (K562) Prostate (PC-3) Esophagus Astrocyte Bone (Osteoblast) Stomach Peripheral Blood (MM.1S) Muscle (Myoblast) Muscle (Myotube) Uterus Thymus Heart
SNP sites on MYOD[chr15:39787334-39787980]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 39787340 rs57661480 G A 3906782
chr15 39787350 rs60613053 C CATTTGTTAAATGAACAAGCACTCAACATAGTACCCAGTAGACGGAGCAGCG 3906783
chr15 39787426 rs8025111 A C,G 3906784
chr15 39787509 rs545311232 G A 3906785
chr15 39787521 rs193179070 G A 3906786
chr15 39787558 rs149500398 A T 3906787
chr15 39787586 rs118124511 G A 3906788
chr15 39787606 rs547167113 T A 3906789
chr15 39787655 rs550577860 A C 3906790
chr15 39787765 rs185481954 A G 3906791
chr15 39787827 rs147242637 C T 3906792
chr15 39787915 rs140847186 C G 3906793
Genes possibly regulated by MYOD[chr15:39787334-39787980]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by MYOD[chr15:39787334-39787980]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results