EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr15:41202898-41203298]
Chromosome characteristics of ZNF274[chr15:41202898-41203298]
Back to top
Enhancers possibly regulated by ZNF274[chr15:41202898-41203298]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 41192765 41214015 enh3543
Bone Marrow (K562) Brain (SK-N-MC) Liver Astrocyte Colon (HCT116) Blood (Karpas-422) Pancreas Uterus Epithelial (MCF-7) Stomach Brain (SK-N-SH) Bone (Osteoblast) Pancreas (Panc1) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Muscle (Myoblast) Heart
SNP sites on ZNF274[chr15:41202898-41203298]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 41202969 rs76189551 C A 3915069
chr15 41203193 rs117322783 C G 3915070
chr15 41203290 rs564882942 AGTCTGCCCCGGGCCAGACCT A 3915071
Genes possibly regulated by ZNF274[chr15:41202898-41203298]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr15:41202898-41203298]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results