EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr15:57614294-57614670]
Chromosome characteristics of ZNF274[chr15:57614294-57614670]
Back to top
Enhancers possibly regulated by ZNF274[chr15:57614294-57614670]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 57611005 57635135 enh3617
Bone Marrow (K562) Prostate (PC-3) Cervix (HeLa-S3) Brain (SK-N-SH) Brain (SK-N-MC) Large Intestine Prostate (RWPE1) Astrocyte Bone (Osteoblast) Stomach Muscle (A673) Colon (HCT116) Blood (Karpas-422) Muscle (Myoblast) Pancreas Spleen Muscle (Myotube) Uterus Thymus Heart
chr15 57614367 57614619 vista20085
VISTA
SNP sites on ZNF274[chr15:57614294-57614670]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 57614310 rs150785927 AGCTTGGGTCCCTTCCAGCAATGAT A 3977494
chr15 57614310 rs532110771 A G 3977495
chr15 57614310 rs59696901 AGCTTGGGTCCCTTCCAGCAATGAT A 3977496
chr15 57614482 rs142297815 C T 3977497
chr15 57614545 rs11631073 C T 3977498
chr15 57614667 rs188532857 C G 3977499
Genes possibly regulated by ZNF274[chr15:57614294-57614670]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr15:57614294-57614670]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results