Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 68299625 68326035 enh16263

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 68303963 rs7495583 A G 4048712
chr15 68304121 rs118171446 G A 4048713
chr15 68304238 rs570964456 C A 4048714
chr15 68304245 rs575758990 G A 4048715
chr15 68304295 rs185473771 C A 4048716
chr15 68304310 rs560520627 G A 4048717
chr15 68304368 rs141442627 G T 4048718
chr15 68304536 rs78246603 G A 4048719
chr15 68304688 rs558342232 T TTGTTGTTTGAAACAACACCTGCCATGTCTCACC 4048720
chr15 68304736 rs140495600 A G 4048721
chr15 68304907 rs560580417 G T 4048722
chr15 68305064 rs117001365 C A 4048723
chr15 68305071 rs79454133 A G 4048724
chr15 68305207 rs10220851 G A 4048725
chr15 68305274 rs12595042 C G 4048726
chr15 68305352 rs77649010 C G 4048727

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results