EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr15:99973202-99973369]
Chromosome characteristics of ZNF274[chr15:99973202-99973369]
Back to top
Enhancers possibly regulated by ZNF274[chr15:99973202-99973369]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 99971645 99998102 enh16467
Bone Marrow (K562) Brain (SK-N-MC) Astrocyte Colon (HCT116) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Brain (SK-N-SH) Ovary Bone (Osteoblast) Thyroid Pancreas (Panc1) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Breast Muscle (Myotube) Prostate (RWPE1) Lung Heart
SNP sites on ZNF274[chr15:99973202-99973369]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 99973214 rs562180728 CCTCTGGTCCTGTCTGGCAGGCAG C 4225559
chr15 99973286 rs74035732 T G 4225560
chr15 99973369 rs7167464 G A 4225561
Genes possibly regulated by ZNF274[chr15:99973202-99973369]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr15:99973202-99973369]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results