EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr15:99985257-99987667]
Chromosome characteristics of ZNF274[chr15:99985257-99987667]
Back to top
Enhancers possibly regulated by ZNF274[chr15:99985257-99987667]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 99971645 99998102 enh16467
Bone Marrow (K562) Brain (SK-N-MC) Astrocyte Colon (HCT116) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Brain (SK-N-SH) Ovary Bone (Osteoblast) Thyroid Pancreas (Panc1) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Breast Muscle (Myotube) Prostate (RWPE1) Lung Heart
SNP sites on ZNF274[chr15:99985257-99987667]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 99985258 rs555794932 G A 4225782
chr15 99985322 rs6598249 G A 4225783
chr15 99985501 rs4965493 A G 4225784
chr15 99985594 rs80112613 G A 4225785
chr15 99985650 rs8027826 C T 4225786
chr15 99985656 rs117625185 C A,T 4225787
chr15 99985657 rs28729391 C T 4225788
chr15 99985687 rs74035743 C G 4225789
chr15 99985738 rs549527966 C T 4225790
chr15 99985789 rs567880995 G A 4225791
chr15 99985913 rs186999962 G A 4225792
chr15 99986010 rs138159624 C T 4225793
chr15 99986066 rs529248017 TTGTTGTTTTG T 4225794
chr15 99986076 rs572731210 GTGT G 4225795
chr15 99986224 rs117861729 C T 4225796
chr15 99986377 rs115251605 G A 4225797
chr15 99986380 rs373790749 G A 4225798
chr15 99986412 rs6598250 G T 4225799
chr15 99986764 rs8032786 G A 4225800
chr15 99986934 rs894416 T C 4225801
chr15 99987027 rs531945735 G A,C 4225802
chr15 99987109 rs4965494 C T 4225803
chr15 99987134 rs566091116 T C 4225804
chr15 99987142 rs35998318 C T 4225805
chr15 99987143 rs181689929 T C 4225806
chr15 99987148 rs4965495 G T 4225807
chr15 99987161 rs4965496 A C 4225808
chr15 99987170 rs4965497 A G 4225809
chr15 99987271 rs143333718 TGGCGCTCGGCCTTCCCCGCTGCCTGCGCGCCTGGGGCGCACACACCTG T 4225810
chr15 99987341 rs143622121 G A 4225811
chr15 99987385 rs185875460 G A 4225812
chr15 99987396 rs373813231 G A 4225813
chr15 99987403 rs115492333 G T 4225814
chr15 99987597 rs11638998 C G,T 4225815
Genes possibly regulated by ZNF274[chr15:99985257-99987667]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr15:99985257-99987667]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results