EnhancerDB
  1. Home
  2. TFBS
  3. TCF7L2[chr15:99986920-99987321]
Chromosome characteristics of TCF7L2[chr15:99986920-99987321]
Back to top
Enhancers possibly regulated by TCF7L2[chr15:99986920-99987321]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 99971645 99998102 enh16467
Bone Marrow (K562) Brain (SK-N-MC) Astrocyte Colon (HCT116) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Brain (SK-N-SH) Ovary Bone (Osteoblast) Thyroid Pancreas (Panc1) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Breast Muscle (Myotube) Prostate (RWPE1) Lung Heart
SNP sites on TCF7L2[chr15:99986920-99987321]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 99986934 rs894416 T C 4225801
chr15 99987027 rs531945735 G A,C 4225802
chr15 99987109 rs4965494 C T 4225803
chr15 99987134 rs566091116 T C 4225804
chr15 99987142 rs35998318 C T 4225805
chr15 99987143 rs181689929 T C 4225806
chr15 99987148 rs4965495 G T 4225807
chr15 99987161 rs4965496 A C 4225808
chr15 99987170 rs4965497 A G 4225809
chr15 99987271 rs143333718 TGGCGCTCGGCCTTCCCCGCTGCCTGCGCGCCTGGGGCGCACACACCTG T 4225810
Genes possibly regulated by TCF7L2[chr15:99986920-99987321]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TCF7L2[chr15:99986920-99987321]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results