EnhancerDB
  1. Home
  2. TFBS
  3. TCF7L2[chr16:1324849-1326652]
Chromosome characteristics of TCF7L2[chr16:1324849-1326652]
Back to top
Enhancers possibly regulated by TCF7L2[chr16:1324849-1326652]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 1326605 1349655 enh16494
Astrocyte Colon (HCT116) Pancreas Stomach Epithelial (MCF-7) Skin (Keratinocyte) Blood (OCI-LY7) Thyroid Peripheral Blood (MM.1S) Pancreas (Panc1) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Muscle (A673)
SNP sites on TCF7L2[chr16:1324849-1326652]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 1324919 rs151329461 C T 4255191
chr16 1324963 rs140582429 C G 4255192
chr16 1324985 rs535864101 C T 4255193
chr16 1324986 rs145639811 G A 4255194
chr16 1325026 rs556470079 T TAC 4255195
chr16 1325152 rs141208115 G A 4255196
chr16 1325237 rs143586210 C CCA,CCACACACACACA 4255197
chr16 1325277 rs36187399 C CCACA 4255198
chr16 1325277 rs71145412 C CCA,CCACA,CCACACACACACACACACACACACACACACGCTCTAGAAAAGGGAGACGGGACCACA 4255199
chr16 1325279 rs74002052 A C 4255200
chr16 1325334 rs138855715 G C 4255201
chr16 1325354 rs532435545 C T 4255202
chr16 1325379 rs528661206 G A 4255203
chr16 1325383 rs548906095 T C 4255204
chr16 1325384 rs562206084 G C 4255205
chr16 1325388 rs529694277 A G 4255206
chr16 1325416 rs148628877 C CCA,CCACA 4255207
chr16 1325416 rs767845958 C CCA 4255208
chr16 1325434 rs73500224 A T 4255209
chr16 1325518 rs532874359 C G 4255210
chr16 1325534 rs114233064 G A 4255211
chr16 1325542 rs116523717 G A 4255212
chr16 1325543 rs554856979 C T 4255213
chr16 1325587 rs574618861 C T 4255214
chr16 1325622 rs73500226 G A 4255215
chr16 1325656 rs189865865 A T 4255216
chr16 1325737 rs573113028 T C 4255217
chr16 1325739 rs73500230 C A 4255218
chr16 1325939 rs144003386 C A 4255219
chr16 1325966 rs532141152 C G 4255220
chr16 1325971 rs1962736 G A 4255221
chr16 1325975 rs148276044 G A 4255222
chr16 1326068 rs548047108 T C 4255223
chr16 1326158 rs536973756 A T 4255224
chr16 1326178 rs557221430 C T 4255225
chr16 1326233 rs188259912 G A 4255226
chr16 1326309 rs562175771 C T 4255227
chr16 1326361 rs575769250 G A 4255228
chr16 1326381 rs1883558 C T 4255229
chr16 1326478 rs192524183 C T 4255230
chr16 1326561 rs550473261 A G 4255231
chr16 1326593 rs539472626 A G 4255232
Genes possibly regulated by TCF7L2[chr16:1324849-1326652]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TCF7L2[chr16:1324849-1326652]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results