EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr16:3214569-3214904]
Chromosome characteristics of ZNF274[chr16:3214569-3214904]
Back to top
Enhancers possibly regulated by ZNF274[chr16:3214569-3214904]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 3205284 3226809 enh62538
Bone Marrow (K562) Liver (HepG2) Cervix (HeLa-S3) Brain (SK-N-MC) Prostate (RWPE1) Esophagus Colon (HCT116) Pancreas Pancreas (Panc1) Uterus Blood (T-cell) Stomach
SNP sites on ZNF274[chr16:3214569-3214904]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 3214569 rs73492498 C T 4267756
chr16 3214578 rs147658587 T C 4267757
chr16 3214582 rs144699980 A G 4267758
chr16 3214605 rs114762930 A T 4267759
chr16 3214607 rs76040810 G A 4267760
chr16 3214643 rs566736384 C CCCTGAGAGGTCCCGGCCTGGAG 4267761
chr16 3214684 rs79412446 G C 4267762
chr16 3214686 rs8059399 G A 4267763
chr16 3214688 rs140825972 C T 4267764
chr16 3214746 rs553881127 C T 4267765
chr16 3214769 rs77257404 C G,T 4267766
chr16 3214770 rs190650597 A G 4267767
chr16 3214791 rs576631436 A G 4267768
Genes possibly regulated by ZNF274[chr16:3214569-3214904]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr16:3214569-3214904]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results