EnhancerDB
  1. Home
  2. TFBS
  3. ZBTB33[chr16:27376590-27377054]
Chromosome characteristics of ZBTB33[chr16:27376590-27377054]
Back to top
Enhancers possibly regulated by ZBTB33[chr16:27376590-27377054]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 27372645 27392475 enh16615
Large Intestine Prostate (RWPE1) Esophagus Astrocyte Blood (T-cell) Bone (Osteoblast) Blood (OCI-LY7) Blood (GM12878) Stomach Muscle (A673) Placenta Colon (HCT116) Peripheral Blood (MM.1S) Muscle (Myoblast) Pancreas Uterus Thymus Epithelial (MCF-7)
SNP sites on ZBTB33[chr16:27376590-27377054]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 27376604 rs529037889 A T 4395384
chr16 27376637 rs2382721 A G 4395385
chr16 27376748 rs72784315 G A,C 4395386
chr16 27376898 rs3024698 T A,C 4395387
chr16 27376910 rs3024685 T C 4395388
chr16 27376928 rs535643067 C T 4395389
chr16 27376991 rs371048257 GGGGTATTTGTCCACCAGCTCCCATCTGTCATT G 4395390
chr16 27376991 rs536606820 GGGGTATTTGTCCACCAGCTCCCATCTGTCATT G 4395391
chr16 27377010 rs35146330 T TC 4395392
chr16 27377010 rs75614111 T TC 4395393
chr16 27377042 rs150499669 G A 4395394
Genes possibly regulated by ZBTB33[chr16:27376590-27377054]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZBTB33[chr16:27376590-27377054]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results