EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr16:66926678-66929499]
Chromosome characteristics of ZNF274[chr16:66926678-66929499]
Back to top
Enhancers possibly regulated by ZNF274[chr16:66926678-66929499]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 66928689 66941975 enh16731
Bone Marrow (K562) Liver (HepG2) Cervix (HeLa-S3) Brain (SK-N-SH) Large Intestine Prostate (RWPE1) Esophagus Astrocyte Ovary Bone (Osteoblast) Lung Stomach Muscle (A673) Placenta Breast Lung (PC-9) Pancreas Muscle (Myotube) Uterus Heart
SNP sites on ZNF274[chr16:66926678-66929499]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 66926750 rs74760485 G A 4494391
chr16 66926815 rs11292861 GT G 4494392
chr16 66926815 rs796224518 GT G 4494393
chr16 66926919 rs72794237 C T 4494394
chr16 66927024 rs12596620 C T 4494395
chr16 66927044 rs62057929 C T 4494396
chr16 66927105 rs534858727 C T 4494397
chr16 66927193 rs12596693 G C 4494398
chr16 66927412 rs533568694 GTGTATATATATATATATATA G 4494399
chr16 66927608 rs186774985 G A 4494400
chr16 66927635 rs537112621 T C 4494401
chr16 66927711 rs183957889 G T 4494402
chr16 66927852 rs113122135 G A 4494403
chr16 66927894 rs564115820 G C 4494404
chr16 66927987 rs192451016 C T 4494405
chr16 66927996 rs80265416 C A 4494406
chr16 66928064 rs186760982 A G 4494407
chr16 66928161 rs58436131 C A,T 4494408
chr16 66928298 rs73584989 G A 4494409
chr16 66928363 rs57558726 G C 4494410
chr16 66928552 rs144432412 G A 4494411
chr16 66928832 rs145319796 A C 4494412
chr16 66928885 rs149169096 T C 4494413
chr16 66928958 rs530961311 C T 4494414
chr16 66929011 rs143269228 G T 4494415
chr16 66929052 rs72794239 G A 4494416
chr16 66929088 rs185072845 G T 4494417
chr16 66929195 rs114488519 A T 4494418
chr16 66929311 rs561978955 G A 4494419
chr16 66929318 rs79603148 G C 4494420
chr16 66929336 rs148300079 C T 4494421
chr16 66929373 rs59405290 T C 4494422
Genes possibly regulated by ZNF274[chr16:66926678-66929499]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr16:66926678-66929499]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results