Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 84837185 84846775 enh16854

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 84837656 rs142281903 G T 4612867
chr16 84837671 rs571943498 G A 4612868
chr16 84837718 rs112114200 G A 4612869
chr16 84837720 rs112877319 C T 4612870
chr16 84837725 rs531709809 G T 4612871
chr16 84837776 rs148395790 T C 4612872
chr16 84837777 rs565809816 G A 4612873
chr16 84837788 rs536206455 A G 4612874
chr16 84837836 rs193271488 A G 4612875
chr16 84837881 rs376276835 T C 4612876
chr16 84837893 rs142518734 C A,G 4612877
chr16 84837931 rs534512023 C T 4612878
chr16 84837972 rs116781552 C T 4612879
chr16 84837996 rs75622773 C T 4612880
chr16 84838011 rs116553024 G C 4612881
chr16 84838022 rs115956054 C G 4612882
chr16 84838033 rs114661474 C T 4612883
chr16 84838063 rs191129239 G A 4612884
chr16 84838072 rs561507776 G A 4612885
chr16 84838110 rs534451183 A C 4612886
chr16 84838110 rs571135702 A AGGTGGAGGACAGCCCTCGTGCAC 4612887

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results