EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr16:84955102-84955993]
Chromosome characteristics of ZNF274[chr16:84955102-84955993]
Back to top
Enhancers possibly regulated by ZNF274[chr16:84955102-84955993]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 84951005 84991295 enh16857
Bone Marrow (K562) Brain (SK-N-SH) Large Intestine Prostate (RWPE1) Esophagus Astrocyte Ovary Bone (Osteoblast) Lung Stomach Placenta Muscle (Myoblast) Pancreas Spleen Muscle (Myotube) Uterus Heart
SNP sites on ZNF274[chr16:84955102-84955993]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 84955168 rs78550033 G T 4614297
chr16 84955224 rs9934949 C G 4614298
chr16 84955421 rs569987624 AGCCAAGATCACACCACTGCACTCCAGCCTGGGT A 4614299
chr16 84955551 rs12599043 C A 4614300
chr16 84955651 rs117109184 C T 4614301
chr16 84955672 rs117502136 A G 4614302
chr16 84955758 rs146704311 T C 4614303
chr16 84955763 rs189903726 G T 4614304
chr16 84955808 rs12925716 G T 4614305
chr16 84955812 rs9935409 A G 4614306
chr16 84955864 rs397971669 G GT 4614307
chr16 84955864 rs59624701 G GT 4614308
chr16 84955864 rs74633387 G T 4614309
Genes possibly regulated by ZNF274[chr16:84955102-84955993]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr16:84955102-84955993]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results