EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr16:84972042-84974678]
Chromosome characteristics of ZNF274[chr16:84972042-84974678]
Back to top
Enhancers possibly regulated by ZNF274[chr16:84972042-84974678]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 84951005 84991295 enh16857
Bone Marrow (K562) Brain (SK-N-SH) Large Intestine Prostate (RWPE1) Esophagus Astrocyte Ovary Bone (Osteoblast) Lung Stomach Placenta Muscle (Myoblast) Pancreas Spleen Muscle (Myotube) Uterus Heart
SNP sites on ZNF274[chr16:84972042-84974678]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 84972051 rs371218923 A AT 4614614
chr16 84972065 rs182210079 C T 4614615
chr16 84972110 rs113091677 G T 4614616
chr16 84972146 rs551339306 A G 4614617
chr16 84972189 rs62048735 T C 4614618
chr16 84972227 rs76618496 G A,T 4614619
chr16 84972236 rs112286960 C T 4614620
chr16 84972273 rs184962698 G A 4614621
chr16 84972299 rs141201508 G C 4614622
chr16 84972350 rs146959593 A G 4614623
chr16 84972450 rs138104623 G C 4614624
chr16 84972504 rs548267531 GAATCGTGTACCCAGGAAGGAATTGT G 4614625
chr16 84972563 rs16974980 A G 4614626
chr16 84972573 rs74031074 G C,T 4614627
chr16 84972597 rs72165774 CTG C 4614628
chr16 84972597 rs869151290 CTG C 4614629
chr16 84972674 rs73259406 C T 4614630
chr16 84972703 rs74031075 G T 4614631
chr16 84972825 rs12921930 A T 4614632
chr16 84972887 rs183186152 C A 4614633
chr16 84972920 rs17189009 A G 4614634
chr16 84972921 rs76420652 A G 4614635
chr16 84972934 rs150160906 G A,T 4614636
chr16 84972980 rs549009602 G T 4614637
chr16 84972986 rs561880378 G C 4614638
chr16 84973036 rs12922284 A C 4614639
chr16 84973048 rs12922292 A G 4614640
chr16 84973104 rs11149695 A G 4614641
chr16 84973118 rs11149696 T C 4614642
chr16 84973165 rs34950724 T A,C 4614643
chr16 84973182 rs11149697 A G 4614644
chr16 84973225 rs139694604 G A,T 4614645
chr16 84973260 rs142939112 C G 4614646
chr16 84973372 rs16974983 T C 4614647
chr16 84973402 rs16974986 A G 4614648
chr16 84973462 rs541649645 G A 4614649
chr16 84973563 rs2934487 G A 4614650
chr16 84973599 rs556976381 G C 4614651
chr16 84973605 rs189076478 G A 4614652
chr16 84973635 rs112896923 A AAGACC 4614653
chr16 84973635 rs373571885 A AAGACC 4614654
chr16 84973637 rs369469019 G A 4614655
chr16 84973639 rs565375306 C G 4614656
chr16 84973654 rs12928162 T G 4614657
chr16 84973688 rs192436098 T G 4614658
chr16 84973696 rs116397429 G C,T 4614659
chr16 84973873 rs531781696 G A,C,T 4614660
chr16 84973880 rs2935536 A C 4614661
chr16 84973918 rs112966389 G A 4614662
chr16 84973944 rs188217746 G A 4614663
chr16 84973980 rs28505229 G A,C 4614664
chr16 84974065 rs147759325 G T 4614665
chr16 84974123 rs9936736 C A 4614666
chr16 84974211 rs184860942 G T 4614667
chr16 84974225 rs190150254 G T 4614668
chr16 84974236 rs9939014 G C 4614669
chr16 84974267 rs62048736 T C 4614670
chr16 84974373 rs78745744 C T 4614671
chr16 84974407 rs17189072 A T 4614672
chr16 84974525 rs8063256 C T 4614673
chr16 84974526 rs182007985 G A 4614674
chr16 84974533 rs17774875 G C 4614675
chr16 84974565 rs147596017 T A 4614676
chr16 84974579 rs142153545 A G 4614677
chr16 84974592 rs12448661 C T 4614678
chr16 84974631 rs116316643 C A 4614679
chr16 84974637 rs59321480 G A 4614680
chr16 84974672 rs200491912 A AC 4614681
chr16 84974672 rs58716565 A AC 4614682
chr16 84974676 rs35176303 C T 4614683
Genes possibly regulated by ZNF274[chr16:84972042-84974678]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr16:84972042-84974678]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results