Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 84951005 84991295 enh16857

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 84972450 rs138104623 G C 4614624
chr16 84972504 rs548267531 GAATCGTGTACCCAGGAAGGAATTGT G 4614625
chr16 84972563 rs16974980 A G 4614626
chr16 84972573 rs74031074 G C,T 4614627
chr16 84972597 rs72165774 CTG C 4614628
chr16 84972597 rs869151290 CTG C 4614629
chr16 84972674 rs73259406 C T 4614630
chr16 84972703 rs74031075 G T 4614631
chr16 84972825 rs12921930 A T 4614632
chr16 84972887 rs183186152 C A 4614633
chr16 84972920 rs17189009 A G 4614634
chr16 84972921 rs76420652 A G 4614635
chr16 84972934 rs150160906 G A,T 4614636
chr16 84972980 rs549009602 G T 4614637
chr16 84972986 rs561880378 G C 4614638
chr16 84973036 rs12922284 A C 4614639
chr16 84973048 rs12922292 A G 4614640
chr16 84973104 rs11149695 A G 4614641
chr16 84973118 rs11149696 T C 4614642
chr16 84973165 rs34950724 T A,C 4614643

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results