Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 84951005 84991295 enh16857

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 84972504 rs548267531 GAATCGTGTACCCAGGAAGGAATTGT G 4614625
chr16 84972563 rs16974980 A G 4614626
chr16 84972573 rs74031074 G C,T 4614627
chr16 84972597 rs72165774 CTG C 4614628
chr16 84972597 rs869151290 CTG C 4614629
chr16 84972674 rs73259406 C T 4614630
chr16 84972703 rs74031075 G T 4614631
chr16 84972825 rs12921930 A T 4614632
chr16 84972887 rs183186152 C A 4614633

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results