EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr16:88147470-88148556]
Chromosome characteristics of ZNF143[chr16:88147470-88148556]
Back to top
Enhancers possibly regulated by ZNF143[chr16:88147470-88148556]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 88148285 88157315 enh16900
Skin (Keratinocyte) Prostate (PC-3) Cervix (HeLa-S3) Prostate (RWPE1) Astrocyte Placenta Pancreas Uterus Epithelial (MCF-7)
SNP sites on ZNF143[chr16:88147470-88148556]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 88147508 rs117094137 C T 4658436
chr16 88147555 rs556990952 G A,T 4658437
chr16 88147567 rs8047694 G A 4658438
chr16 88147586 rs185443666 G A 4658439
chr16 88147673 rs189751795 C T 4658440
chr16 88147728 rs563194698 C A 4658441
chr16 88147761 rs74204505 C G 4658442
chr16 88147782 rs538243971 G GGGGGAGAATGACAGGGACCACACTCACTCACTGCGGGGGTCTCC 4658443
chr16 88147803 rs7499787 T C 4658444
chr16 88147827 rs546863751 G A 4658445
chr16 88147864 rs7499810 T G 4658446
chr16 88147870 rs112850167 C G,T 4658447
chr16 88147914 rs555254012 C T 4658448
chr16 88147969 rs188726176 A G 4658449
chr16 88148035 rs183247094 C T 4658450
chr16 88148045 rs111774232 C A 4658451
chr16 88148070 rs534246240 CACTG C 4658452
chr16 88148089 rs111295846 C A,T 4658453
chr16 88148091 rs202147417 GGTT G 4658454
chr16 88148096 rs528614167 G T 4658455
chr16 88148106 rs546798437 G C 4658456
chr16 88148115 rs187099387 C T 4658457
chr16 88148152 rs116598994 C T 4658458
chr16 88148261 rs77328360 C G,T 4658459
chr16 88148286 rs566855563 C T 4658460
chr16 88148335 rs138235546 G A 4658461
chr16 88148451 rs8049251 G A 4658462
chr16 88148480 rs201554219 T TG 4658463
chr16 88148514 rs556990402 G A 4658464
Genes possibly regulated by ZNF143[chr16:88147470-88148556]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr16:88147470-88148556]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results