EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr17:7029425-7030327]
Chromosome characteristics of ZNF274[chr17:7029425-7030327]
Back to top
Enhancers possibly regulated by ZNF274[chr17:7029425-7030327]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 7029585 7039135 enh16956
Liver (HepG2) Brain (SK-N-MC) Large Intestine Blood (T-cell) Blood (OCI-LY7) Blood (GM12878) Stomach Muscle (A673) Placenta Peripheral Blood (MM.1S) Embryonic Stem Cell Line (H1-hESC) Neural Stem Cells (H9) Thymus Heart
SNP sites on ZNF274[chr17:7029425-7030327]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 7029454 rs2047774 G A 4728056
chr17 7029487 rs141965396 G A 4728057
chr17 7029549 rs2053595 G A 4728058
chr17 7029585 rs6503008 A G 4728059
chr17 7029629 rs150665177 G A 4728060
chr17 7029890 rs111927485 T C 4728061
chr17 7030002 rs530463264 G A 4728062
chr17 7030026 rs572185796 G A 4728063
chr17 7030053 rs62061396 T G 4728064
chr17 7030146 rs565682978 G GTCACGCTCCTAGTCCGCCT 4728065
chr17 7030150 rs147878391 C T 4728066
chr17 7030210 rs112085353 T C 4728067
Genes possibly regulated by ZNF274[chr17:7029425-7030327]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr17:7029425-7030327]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results