Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 39686995 rs188713762 G A 4873254
chr17 39687048 rs149863375 C T 4873255
chr17 39687081 rs144677091 G A 4873256
chr17 39687134 rs532235458 T A 4873257
chr17 39687320 rs16967083 G T 4873258
chr17 39687361 rs144278268 G A,T 4873259
chr17 39687398 rs548927250 G A 4873260
chr17 39687481 rs530976124 G A 4873261
chr17 39687542 rs146567622 A C,G 4873262
chr17 39687569 rs377093758 T A 4873263
chr17 39687593 rs144895400 CCCTGTCAAATAAGATCGGAAA C 4873264
chr17 39687593 rs372178829 CCCTGTCAAATAAGATCGGAAA C 4873265
chr17 39687603 rs568146654 T A 4873266
chr17 39687632 rs16967085 C G 4873267
chr17 39687713 rs114763921 T G 4873268
chr17 39687716 rs182167030 G T 4873269
chr17 39687790 rs10678297 C CACA 4873270
chr17 39687790 rs397795495 C CACA 4873271
chr17 39687817 rs55648333 C CATT 4873272
chr17 39687817 rs769080209 C CATT 4873273
chr17 39688191 rs558467088 G A 4873274
chr17 39688342 rs75607086 A G 4873275
chr17 39688476 rs546508086 A G 4873276
chr17 39688477 rs4796788 T C 4873277
chr17 39688505 rs114721042 T C 4873278
chr17 39688505 rs574896861 TG T 4873279
chr17 39688599 rs4796778 C A 4873280
chr17 39688618 rs143324080 A T 4873281
chr17 39688817 rs11651502 G T 4873282
chr17 39688818 rs11656698 A T 4873283
chr17 39688891 rs151198064 C T 4873284
chr17 39688932 rs114043730 G A 4873285
chr17 39689192 rs561983849 C T 4873286

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results