Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 48854945 48879175 enh17223

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 48878848 rs4793673 A G 4925673
chr17 48878943 rs534691087 GGTGGCTGGATCATTCATGGAGAGA G 4925674
chr17 48879061 rs147472805 G A 4925675
chr17 48879108 rs757610 T A,C 4925676
chr17 48879203 rs117755098 C G 4925677
chr17 48879311 rs139983446 T C 4925678
chr17 48879366 rs573473786 G A,C 4925679
chr17 48879449 rs574954776 T A 4925680
chr17 48879523 rs79853469 G A 4925681

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results