EnhancerDB
  1. Home
  2. TFBS
  3. P63[chr17:49509031-49509626]
Chromosome characteristics of P63[chr17:49509031-49509626]
Back to top
Enhancers possibly regulated by P63[chr17:49509031-49509626]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 49502285 49519023 enh48044
Skin (Keratinocyte) Blood (T-cell) Esophagus Colon (HCT116) Thyroid Pancreas Spleen Thymus Heart
SNP sites on P63[chr17:49509031-49509626]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 49509246 rs552200542 T C 4929822
chr17 49509335 rs184121108 C T 4929823
chr17 49509375 rs576726300 A ATCTTTTCCATTACATGATG 4929824
chr17 49509499 rs11657379 T C 4929825
chr17 49509615 rs151049540 A T 4929826
Genes possibly regulated by P63[chr17:49509031-49509626]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by P63[chr17:49509031-49509626]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results