EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr17:60265094-60265336]
Chromosome characteristics of ZNF274[chr17:60265094-60265336]
Back to top
Enhancers possibly regulated by ZNF274[chr17:60265094-60265336]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 60253851 60272895 enh17275
Bone Marrow (K562) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Prostate (RWPE1) Stomach Muscle (A673) Placenta Colon (HCT116) Lung (PC-9) Pancreas (Panc1) Neural Stem Cells (H9) Epithelial (MCF-7)
SNP sites on ZNF274[chr17:60265094-60265336]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 60265132 rs150067881 G GGGATTACAGGCATGAGCTACT 4972129
chr17 60265132 rs59469008 G GGGATTACAGGCATGAGCTACT 4972130
Genes possibly regulated by ZNF274[chr17:60265094-60265336]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr17:60265094-60265336]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results