EnhancerDB
  1. Home
  2. TFBS
  3. TCF7L2[chr17:62673810-62674839]
Chromosome characteristics of TCF7L2[chr17:62673810-62674839]
Back to top
Enhancers possibly regulated by TCF7L2[chr17:62673810-62674839]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 62671385 62687563 enh17299
Skin (Keratinocyte) Prostate (PC-3) Liver (HepG2) Cervix (HeLa-S3) Prostate (RWPE1) Astrocyte Bone (Osteoblast) Placenta Colon (HCT116) Lung (PC-9) Muscle (Myoblast) Muscle (Myotube) Epithelial (MCF-7)
SNP sites on TCF7L2[chr17:62673810-62674839]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 62674181 rs554894254 A AC 4984807
chr17 62674222 rs193200992 T A 4984808
chr17 62674232 rs557037923 C CTA 4984809
chr17 62674252 rs531652270 C G 4984810
chr17 62674257 rs8080013 C T 4984811
chr17 62674259 rs564831951 T TACTATATATATAGTATATATAGTGTAC 4984812
chr17 62674263 rs576151058 CTA C 4984813
chr17 62674285 rs568776867 G A 4984814
chr17 62674325 rs139209277 T C 4984815
chr17 62674326 rs548030693 G A 4984816
chr17 62674341 rs536492916 A G 4984817
Genes possibly regulated by TCF7L2[chr17:62673810-62674839]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TCF7L2[chr17:62673810-62674839]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results