EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr17:73073296-73073686]
Chromosome characteristics of ZNF274[chr17:73073296-73073686]
Back to top
Enhancers possibly regulated by ZNF274[chr17:73073296-73073686]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 73060005 73078443 enh17373
Bone Marrow (K562) Prostate (PC-3) Liver (HepG2) Large Intestine Prostate (RWPE1) Blood (T-cell) Astrocyte Bone (Osteoblast) Blood (GM12878) Muscle (A673) Placenta Colon (HCT116) Peripheral Blood (MM.1S) Lung (PC-9) Muscle (Myoblast) Muscle (Myotube) Uterus Thymus
chr17 73073656 73074040 vista25958
VISTA
SNP sites on ZNF274[chr17:73073296-73073686]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 73073583 rs80231131 C T 5053702
chr17 73073611 rs142373732 G GACTCGCTCAAGTTATCGGTGTGGC 5053703
chr17 73073611 rs61187458 G GACTCGCTCAAGTTATCGGTGTGGC 5053704
Genes possibly regulated by ZNF274[chr17:73073296-73073686]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr17:73073296-73073686]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results