EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr17:76600488-76603014]
Chromosome characteristics of ZNF274[chr17:76600488-76603014]
Back to top
Enhancers possibly regulated by ZNF274[chr17:76600488-76603014]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 76582585 76603155 enh17410
Bone Marrow (K562) Prostate (PC-3) Liver (HepG2) Cervix (HeLa-S3) Brain (SK-N-MC) Large Intestine Prostate (RWPE1) Astrocyte Bone (Osteoblast) Stomach Muscle (A673) Placenta Lung (PC-9) Muscle (Myotube) Uterus Epithelial (MCF-7)
SNP sites on ZNF274[chr17:76600488-76603014]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 76600654 rs78343232 G A 5088055
chr17 76600663 rs554625325 G A 5088056
chr17 76600833 rs141967270 C A 5088057
chr17 76600873 rs78667924 G A 5088058
chr17 76600967 rs61696832 T C 5088059
chr17 76601240 rs573456755 GTGCTGGGATTACAGGCATGAGCTGCC G 5088060
chr17 76601250 rs528426288 T C 5088061
chr17 76601266 rs139100878 C T 5088062
chr17 76601272 rs561883935 C T 5088063
chr17 76601363 rs8080124 T C 5088064
chr17 76601405 rs8079177 C T 5088065
chr17 76601442 rs111400766 A G 5088066
chr17 76601630 rs148686822 T G 5088067
chr17 76601811 rs73385210 G A 5088068
chr17 76601902 rs564013582 A G 5088069
chr17 76601951 rs117363993 C T 5088070
chr17 76601995 rs77173269 A G 5088071
chr17 76602116 rs78344078 G C 5088072
chr17 76602203 rs59469896 C G 5088073
chr17 76602236 rs60643927 C A,G 5088074
chr17 76602243 rs113380198 C T 5088075
chr17 76602257 rs370405948 G A 5088076
chr17 76602339 rs77126070 T C 5088077
chr17 76602404 rs11869117 A G 5088078
chr17 76602452 rs72924959 G A,T 5088079
chr17 76602467 rs564330504 C T 5088080
chr17 76602600 rs559857669 G A 5088081
chr17 76602631 rs141592546 G A 5088082
chr17 76602694 rs62073847 C T 5088083
chr17 76602714 rs61169407 A G 5088084
chr17 76602733 rs550866955 C A,T 5088085
chr17 76602806 rs117746832 A C 5088086
chr17 76602814 rs200845620 C CA,CAA 5088087
chr17 76602853 rs569032134 A G 5088088
chr17 76602855 rs538148833 A G 5088089
chr17 76602927 rs200519736 A G,T 5088090
chr17 76602964 rs577407198 T C 5088091
Genes possibly regulated by ZNF274[chr17:76600488-76603014]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr17:76600488-76603014]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results