EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr17:76601036-76601404]
Chromosome characteristics of ZNF143[chr17:76601036-76601404]
Back to top
Enhancers possibly regulated by ZNF143[chr17:76601036-76601404]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 76582585 76603155 enh17410
Bone Marrow (K562) Prostate (PC-3) Liver (HepG2) Cervix (HeLa-S3) Brain (SK-N-MC) Large Intestine Prostate (RWPE1) Astrocyte Bone (Osteoblast) Stomach Muscle (A673) Placenta Lung (PC-9) Muscle (Myotube) Uterus Epithelial (MCF-7)
SNP sites on ZNF143[chr17:76601036-76601404]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 76601240 rs573456755 GTGCTGGGATTACAGGCATGAGCTGCC G 5088060
chr17 76601250 rs528426288 T C 5088061
chr17 76601266 rs139100878 C T 5088062
chr17 76601272 rs561883935 C T 5088063
chr17 76601363 rs8080124 T C 5088064
Genes possibly regulated by ZNF143[chr17:76601036-76601404]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr17:76601036-76601404]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results