Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 78418565 78432855 enh4627

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 78421390 rs7220657 G C 5101776
chr17 78421673 rs186329437 T C 5101777
chr17 78421681 rs146149161 G A 5101778
chr17 78421793 rs138931508 T C 5101779
chr17 78421856 rs191514286 A G 5101780
chr17 78421870 rs536089803 A T 5101781
chr17 78421879 rs574213007 TCCCTCAAAGGCAGTTCTGAGGTCA T 5101782
chr17 78421903 rs12952978 A T 5101783
chr17 78421932 rs182078648 C T 5101784
chr17 78422002 rs12603602 T C 5101785
chr17 78422031 rs150722694 C T 5101786

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results