EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr17:78421494-78421901]
Chromosome characteristics of ZNF274[chr17:78421494-78421901]
Back to top
Enhancers possibly regulated by ZNF274[chr17:78421494-78421901]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 78418565 78432855 enh4627
Bone Marrow (K562) Prostate (RWPE1) Blood (Karpas-422) Pancreas Pancreas (Panc1) Uterus Stomach
SNP sites on ZNF274[chr17:78421494-78421901]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 78421673 rs186329437 T C 5101777
chr17 78421681 rs146149161 G A 5101778
chr17 78421793 rs138931508 T C 5101779
chr17 78421856 rs191514286 A G 5101780
chr17 78421870 rs536089803 A T 5101781
chr17 78421879 rs574213007 TCCCTCAAAGGCAGTTCTGAGGTCA T 5101782
Genes possibly regulated by ZNF274[chr17:78421494-78421901]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr17:78421494-78421901]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results