EnhancerDB
  1. Home
  2. TFBS
  3. TCF7L2[chr17:79024041-79025117]
Chromosome characteristics of TCF7L2[chr17:79024041-79025117]
Back to top
Enhancers possibly regulated by TCF7L2[chr17:79024041-79025117]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 79008825 79027145 enh17433
Astrocyte Colon (HCT116) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Brain (SK-N-SH) Bone (Osteoblast) Thyroid Peripheral Blood (MM.1S) Pancreas (Panc1) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Breast Muscle (Myoblast) Muscle (Myotube) Lung Muscle (A673) Heart
chr17 79024187 79024380 vista26372
VISTA
SNP sites on TCF7L2[chr17:79024041-79025117]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 79024076 rs4969365 A G 5109263
chr17 79024157 rs544212403 C CCTGCCCGCTGT,CCTGCCCGCTGTCTGCCCGCTGT 5109264
chr17 79024163 rs55745320 C T 5109265
chr17 79024167 rs35425500 G C 5109266
chr17 79024185 rs372506615 G A 5109267
chr17 79024274 rs375170535 G A 5109268
chr17 79024284 rs554525747 C T 5109269
chr17 79024364 rs560713752 C T 5109270
chr17 79024365 rs8066732 G A 5109271
chr17 79024475 rs146608989 A G 5109272
chr17 79024518 rs112145291 C T 5109273
chr17 79024546 rs555493601 GAC G 5109274
chr17 79024591 rs560524100 A G 5109275
chr17 79024637 rs8067235 G A 5109276
chr17 79024649 rs550722937 T G 5109277
chr17 79024697 rs116021696 C T 5109278
chr17 79024834 rs576497955 C T 5109279
chr17 79024865 rs113904948 C G 5109280
chr17 79024869 rs149863889 C T 5109281
chr17 79024915 rs8069327 A C 5109282
chr17 79024927 rs186614345 C T 5109283
chr17 79024930 rs147402717 CT C 5109284
chr17 79024999 rs577545452 CA C 5109285
chr17 79025010 rs531816344 G A 5109286
chr17 79025040 rs193131218 C T 5109287
chr17 79025063 rs9914904 C T 5109288
Genes possibly regulated by TCF7L2[chr17:79024041-79025117]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TCF7L2[chr17:79024041-79025117]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results