Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 79024157 rs544212403 C CCTGCCCGCTGT,CCTGCCCGCTGTCTGCCCGCTGT 5109264
chr17 79024163 rs55745320 C T 5109265
chr17 79024167 rs35425500 G C 5109266
chr17 79024185 rs372506615 G A 5109267
chr17 79024274 rs375170535 G A 5109268
chr17 79024284 rs554525747 C T 5109269

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results