EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr17:79064719-79064963]
Chromosome characteristics of ZNF274[chr17:79064719-79064963]
Back to top
Enhancers possibly regulated by ZNF274[chr17:79064719-79064963]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 79058967 79071355 enh17435
Bone Marrow (K562) Brain (SK-N-MC) Astrocyte Colon (HCT116) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Thyroid Pancreas (Panc1) Thymus Prostate (PC-3) Large Intestine Esophagus Placenta Lung (PC-9) Breast Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Muscle (A673) Heart
chr17 79064673 79065032 vista26378
VISTA
SNP sites on ZNF274[chr17:79064719-79064963]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 79064722 rs577710007 G A 5109956
chr17 79064730 rs141388692 C T 5109957
chr17 79064844 rs538392577 CCCCGCCCCCACTTGTGTGGA C 5109958
chr17 79064851 rs575884626 C A 5109959
Genes possibly regulated by ZNF274[chr17:79064719-79064963]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr17:79064719-79064963]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results