EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr19:557157-557614]
Chromosome characteristics of ZNF274[chr19:557157-557614]
Back to top
Enhancers possibly regulated by ZNF274[chr19:557157-557614]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 552765 561015 enh17834
Bone Marrow (K562) Liver (HepG2) Cervix (HeLa-S3) Epithelial (MCF-7) Prostate (RWPE1) Ovary Lung Stomach Muscle (A673) Placenta Colon (HCT116) Uterus Heart
SNP sites on ZNF274[chr19:557157-557614]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 557174 rs572578987 C T 5365142
chr19 557185 rs117434807 C T 5365143
chr19 557251 rs57761084 C T 5365144
chr19 557411 rs200183407 C CA 5365145
chr19 557432 rs143617374 G A 5365146
chr19 557448 rs570212670 G A 5365147
chr19 557494 rs112974464 C T 5365148
chr19 557531 rs139646572 C T 5365149
chr19 557573 rs566328486 C T 5365150
chr19 557596 rs202031231 GCTGGTCTCAGGTGATCCAC G 5365151
Genes possibly regulated by ZNF274[chr19:557157-557614]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr19:557157-557614]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results