Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 1174025 1184042 enh17839

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 1174016 rs568596329 G GGCGGGGGTCCCGCCGCGCTCGCCCCCGCCCCA 5372777
chr19 1174022 rs555650715 G A 5372778
chr19 1174313 rs564527169 C G 5372779
chr19 1174316 rs531966652 G T 5372780
chr19 1174317 rs201384443 C CG 5372781
chr19 1174349 rs550360871 A C 5372782
chr19 1174401 rs376386875 C T 5372783
chr19 1174407 rs140554381 C G,T 5372784
chr19 1174414 rs873073 G A,C,T 5372785
chr19 1174553 rs188506748 C A 5372786

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr19 1107636 1174282 - SBNO2 ENSG00000064932.11 1174282 0.75 1.0 288 16735


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results