EnhancerDB
  1. Home
  2. TFBS
  3. ZZZ3[chr19:2489281-2489424]
Chromosome characteristics of ZZZ3[chr19:2489281-2489424]
Back to top
Enhancers possibly regulated by ZZZ3[chr19:2489281-2489424]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 2481141 2509475 enh4958
Bone Marrow (K562) Astrocyte Blood (Karpas-422) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Bone (Osteoblast) Blood (OCI-LY7) Thyroid Peripheral Blood (MM.1S) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Muscle (Myoblast) Spleen Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Muscle (A673)
chr19 2489253 2489454 vista28221
VISTA
SNP sites on ZZZ3[chr19:2489281-2489424]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 2489362 rs553830828 TCGGGCACTGCGCCAGGGCC T 5384738
chr19 2489381 rs540484738 C T 5384739
chr19 2489423 rs186928258 C T 5384740
Genes possibly regulated by ZZZ3[chr19:2489281-2489424]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZZZ3[chr19:2489281-2489424]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results