| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr19 | 7855285 | 7886615 | enh17897 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr19 | 7883856 | rs377491230 | TGCTTGTAGGCATACACCTACAAGGATGTATCAGTTC | T | 5425096 | |
| chr19 | 7883856 | rs551640079 | TGCTTGTAGGCATACACCTACAAGGATGTATCAGTTC | T | 5425097 | |
| chr19 | 7883892 | rs517737 | C | A | 5425098 | |
| chr19 | 7883973 | rs535049058 | C | T | 5425099 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|