EnhancerDB
  1. Home
  2. TFBS
  3. TCF7L2[chr19:10593990-10594475]
Chromosome characteristics of TCF7L2[chr19:10593990-10594475]
Back to top
Enhancers possibly regulated by TCF7L2[chr19:10593990-10594475]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 10587549 10596547 enh86301
Bone Marrow (K562) Prostate (RWPE1) Bone (Osteoblast) Colon (HCT116) Pancreas Pancreas (Panc1) Uterus Blood (T-cell) Stomach
SNP sites on TCF7L2[chr19:10593990-10594475]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 10593996 rs112272449 A G 5436801
chr19 10594115 rs138523949 A G 5436802
chr19 10594170 rs141567219 A G 5436803
chr19 10594185 rs139501559 TAGTC T 5436804
chr19 10594185 rs371945323 TAGTC T 5436805
chr19 10594327 rs188535059 A G 5436806
chr19 10594332 rs142859149 TGTTCCTTTTCTAACTTTCTTTCTCTGGAAATA T 5436807
chr19 10594332 rs367807438 TGTTCCTTTTCTAACTTTCTTTCTCTGGAAATA T 5436808
Genes possibly regulated by TCF7L2[chr19:10593990-10594475]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TCF7L2[chr19:10593990-10594475]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results