Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 10587549 10596547 enh86301

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 10594327 rs188535059 A G 5436806
chr19 10594332 rs142859149 TGTTCCTTTTCTAACTTTCTTTCTCTGGAAATA T 5436807
chr19 10594332 rs367807438 TGTTCCTTTTCTAACTTTCTTTCTCTGGAAATA T 5436808
chr19 10594484 rs115347026 T C 5436809

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results