Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 39559645 39572135 enh31305

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 39560651 rs571764925 GGCACATGTATACATAGGTAACAAACCT G 3904072
chr15 39560657 rs140001963 T A,C 3904073

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results