Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 39621746 39629695 enh62454
chr15 39627132 39627473 vista19669

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 39627413 rs138739597 CCACCACTCTTCCTCATGGCCCCT C 3905075
chr15 39627413 rs377611952 CCACCACTCTTCCTCATGGCCCCT C 3905076

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results