Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
---|---|---|---|---|---|
chr15 | 41539463 | 41554335 | enh3544 |
|
Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
---|---|---|---|---|---|---|
chr15 | 41545621 | rs373688528 | G | GCATT,GTATT,GTATTTATTTATT,GTTTTATT | 3916905 | |
chr15 | 41545621 | rs527841412 | GTATTTATTTATTTATTTATTTATT | G | 3916906 |
Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
---|
Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
---|