Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 59530285 59548213 enh3624

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 59547613 rs530551287 A G 3991683
chr15 59547615 rs530939813 A ATGGAGTCTCACTCTGTCACTCAGGC 3991684
chr15 59547615 rs549049101 A C 3991685

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results