Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 62844283 62853555 enh52038

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 62850700 rs548296539 ATTGGAACAGACCCCGTTCTTAG A 4011936

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results